FANDOM


Yuzo: P-Glycoprotein: Gene SequenceEdit

This is the gene sequence from the P-Glycoprotein in Homo Sapiens. The mRNA sequence is 4718bp long.

The reference sequence can be found HERE (NM_000927)

Genomic SequenceEdit

        1 gccaagaaca aaatatatca agataaggaa aatttgtagt caagaataga aaaaaattat
       61 ggctttgaag tatgagttat ttaaagaaag tggaaacatc ctcagactat gcagtaaaaa
      121 acaaagtgat tttcttcttc taaacttatg caataaactg ataggtaata tgtgaaagtc
      181 atagaatgta gactagagga tacaacaaac ctatttcctc tatgttcata agaagtaaga
      241 aaagctctga tgtgagttag cattgcttta caattttgaa ttgtgcagat tgcacgtact
      301 tttcctcagt ttgaagtaaa tagtggacag gaaaaaatat taaatgttgg cagtaaatat
      361 ggaaggaaat tacaactaat gtaatatgct aaaacatgct atgtttattt tactaatttg
      421 aattaaaatg taagaattta aaatgccctg gaaaaacacg ggcattgatc tgacgtctga
      481 agttttaaaa tattacacac tttgaaatag catttgtacc ttgaaatacc tgtctctata
      541 tattttttaa aacttccttt ttctttcatt ccatttatca tcaaataaag gatgaacaga
      601 tgtaactcag aaactgtcaa gcatgctgaa gaaagaccac tgcagaaaaa tttctcctag
      661 ccttttcaaa ggtgttagga agcagaaagg tgatacagaa ttggagaggt cggagttttt
      721 gtattaactg tattaaatgc gaatcccgag aaaatttccc ttaactacgt cctgtagtta
      781 tatggatatg aagacttatg tgaactttga aagacgtgtc tacataagtt gaaatgtccc
      841 caatgattca gctgatgcgc gtttctctac ttgccctttc tagagaggtg caacggaagc
      901 cagaacattc ctcctggaaa ttcaacctgt ttcgcagttt ctcgaggaat cagcattcag
      961 tcaatccggg ccgggagcag tcatctgtgg tgaggctgat tggctgggca ggaacagcgc
     1021 cggggcgtgg gctgagcaca gccgcttcgc tctctttgcc acaggaagcc tgagctcatt
     1081 cgagtagcgg ctcttccaag ctcaaagaag cagaggccgc tgttcgtttc ctttaggtct
     1141 ttccactaaa gtcggagtat cttcttccaa aatttcacgt cttggtggcc gttccaagga
     1201 gcgcgaggta ggggcacgca aagctgggag ctactatggg acagttccca agtgtcaggc
     1261 tttcagattt cctgaacttg gtcttcacgg gagaagggct tcttgaggcg tggatagtgt
     1321 gaagtcctct ggcaagtcca tggggaccaa gtggggttag atctagactc aggagctcct
     1381 ggagcagcgc ccaaaccgta gtggcactgg accatgttgc ccggagcgcg cacagcccgc
     1441 gcggtgcggg gacctgctct ctgagcccgc gggcggtggg tgggaggaag catcgtccgc
     1501 ggcgactgga accgggaggg agaatcgcac tggcggcggg caaagtccag aacgcgctgc
     1561 cagaccccca actctgcctt cgtggagatg ctggagaccc cgcgcacagg aaagcccctg
     1621 cagtgcccat cgcggccaga gcagctgggg catcaacggc gggcgctccc tcttactgct
     1681 ctctggcttc gacgggggac tagaggttag tctcacctcc agcgcgcctg aggctcatgc
     1741 atttggctaa tgagctgcgg tttctcttca ggtcgggatg gatcttgaag gggaccgcaa
     1801 tggaggagca aagaagaaga acttttttaa actgaacaat aaaaggtaac tagcttgttt
     1861 cattttcata gtttacatag ttgcgagatt tgagtaattt atttctagcc tccagctctg
     1921 aaataaatga catgttgttg tttttaatta tttttaagaa acgcaagcta gcctttggaa
     1981 tcaatatccc tgcttagagc agaagtttgt tggctgagtg gagcacagca tatgcatttt
     2041 ccctgtcttt tttgttcttt cttttaatga tacataatat tttacatatt tatgaaatgg
     2101 ggtacatgga agcgtttttt acatgcccgg aatgtgtaat gatcaagtcc gggtatttga
     2161 aggatacatc accttaggta tatttcattt ctatgtgttg ataacatttt aagtcttcta
     2221 gctactttga aatatacaat atattgctaa ctgtagtcac cctcgtctgc tatcgaacat
     2281 tggaacttat ttgtcctatc caaccgttct tagtcattca ccaacctctt ttcatttcac
     2341 ctttttaccc ttcccggcct ctttccctta gtcttggtgt gcctctttct cagctttcct
     2401 gccccagaca ggcggatgct catatgtgtt tctgtcttat gaacttctgc ttttcaagtg
     2461 gtgttggtcg cccacacgtg agccatatgc tgctggtgat ctgctctgtg gtccaggctc
     2521 ttgcttccgg taaatggcta tgtaaacatc gcgtttgtgg cctggctgat gagacagaag
     2581 gtcaaaagta catttaggtt gttaactggc aataaatatc tgtatataat attggtaatg
     2641 taatcatata gggaaaataa ttatttaaag taaattttga tcatggtgct ctgcctttat
     2701 agaatattta aaacttcact aaatagattc attgttagta gtaaattgta aaatagacta
     2761 gtaagtttaa taatattaga aactgtaatg taaattataa gataaattag ctaaacacat
     2821 taatattata agaaaccaag cttttcagtg taagagaaaa aatacaaatg tggaaatcaa
     2881 atacattttt aaaaataatg ttaagtttga attagaaatt tcaatatgaa tt

mRNA SequenceEdit

>gi|318037598|ref|NM_000927.4| Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 1 (ABCB1), mRNA

AAACACTTGTATTACCATTTTAAAGGCTATCATTACTCTTTACCTGTGAAGAGTAGAACATGAAGAAATC
TACTTTATTCAGATATTCTCCAGATTCCTAAAGATTAGAGATCATTTCTCATTCTCCTAGGAGTACTCAC
TTCAGGAAGCAACCAGATAAAAGAGAGGTGCAACGGAAGCCAGAACATTCCTCCTGGAAATTCAACCTGT
TTCGCAGTTTCTCGAGGAATCAGCATTCAGTCAATCCGGGCCGGGAGCAGTCATCTGTGGTGAGGCTGAT
TGGCTGGGCAGGAACAGCGCCGGGGCGTGGGCTGAGCACAGCCGCTTCGCTCTCTTTGCCACAGGAAGCC
TGAGCTCATTCGAGTAGCGGCTCTTCCAAGCTCAAAGAAGCAGAGGCCGCTGTTCGTTTCCTTTAGGTCT
TTCCACTAAAGTCGGAGTATCTTCTTCCAAAATTTCACGTCTTGGTGGCCGTTCCAAGGAGCGCGAGGTC
GGAATGGATCTTGAAGGGGACCGCAATGGAGGAGCAAAGAAGAAGAACTTTTTTAAACTGAACAATAAAA
GTGAAAAAGATAAGAAGGAAAAGAAACCAACTGTCAGTGTATTTTCAATGTTTCGCTATTCAAATTGGCT
TGACAAGTTGTATATGGTGGTGGGAACTTTGGCTGCCATCATCCATGGGGCTGGACTTCCTCTCATGATG
CTGGTGTTTGGAGAAATGACAGATATCTTTGCAAATGCAGGAAATTTAGAAGATCTGATGTCAAACATCA
CTAATAGAAGTGATATCAATGATACAGGGTTCTTCATGAATCTGGAGGAAGACATGACCAGGTATGCCTA
TTATTACAGTGGAATTGGTGCTGGGGTGCTGGTTGCTGCTTACATTCAGGTTTCATTTTGGTGCCTGGCA
GCTGGAAGACAAATACACAAAATTAGAAAACAGTTTTTTCATGCTATAATGCGACAGGAGATAGGCTGGT
TTGATGTGCACGATGTTGGGGAGCTTAACACCCGACTTACAGATGATGTCTCCAAGATTAATGAAGGAAT
TGGTGACAAAATTGGAATGTTCTTTCAGTCAATGGCAACATTTTTCACTGGGTTTATAGTAGGATTTACA
CGTGGTTGGAAGCTAACCCTTGTGATTTTGGCCATCAGTCCTGTTCTTGGACTGTCAGCTGCTGTCTGGG
CAAAGATACTATCTTCATTTACTGATAAAGAACTCTTAGCGTATGCAAAAGCTGGAGCAGTAGCTGAAGA
GGTCTTGGCAGCAATTAGAACTGTGATTGCATTTGGAGGACAAAAGAAAGAACTTGAAAGGTACAACAAA
AATTTAGAAGAAGCTAAAAGAATTGGGATAAAGAAAGCTATTACAGCCAATATTTCTATAGGTGCTGCTT
TCCTGCTGATCTATGCATCTTATGCTCTGGCCTTCTGGTATGGGACCACCTTGGTCCTCTCAGGGGAATA
TTCTATTGGACAAGTACTCACTGTATTCTTTTCTGTATTAATTGGGGCTTTTAGTGTTGGACAGGCATCT
CCAAGCATTGAAGCATTTGCAAATGCAAGAGGAGCAGCTTATGAAATCTTCAAGATAATTGATAATAAGC
CAAGTATTGACAGCTATTCGAAGAGTGGGCACAAACCAGATAATATTAAGGGAAATTTGGAATTCAGAAA
TGTTCACTTCAGTTACCCATCTCGAAAAGAAGTTAAGATCTTGAAGGGTCTGAACCTGAAGGTGCAGAGT
GGGCAGACGGTGGCCCTGGTTGGAAACAGTGGCTGTGGGAAGAGCACAACAGTCCAGCTGATGCAGAGGC
TCTATGACCCCACAGAGGGGATGGTCAGTGTTGATGGACAGGATATTAGGACCATAAATGTAAGGTTTCT
ACGGGAAATCATTGGTGTGGTGAGTCAGGAACCTGTATTGTTTGCCACCACGATAGCTGAAAACATTCGC
TATGGCCGTGAAAATGTCACCATGGATGAGATTGAGAAAGCTGTCAAGGAAGCCAATGCCTATGACTTTA
TCATGAAACTGCCTCATAAATTTGACACCCTGGTTGGAGAGAGAGGGGCCCAGTTGAGTGGTGGGCAGAA
GCAGAGGATCGCCATTGCACGTGCCCTGGTTCGCAACCCCAAGATCCTCCTGCTGGATGAGGCCACGTCA
GCCTTGGACACAGAAAGCGAAGCAGTGGTTCAGGTGGCTCTGGATAAGGCCAGAAAAGGTCGGACCACCA
TTGTGATAGCTCATCGTTTGTCTACAGTTCGTAATGCTGACGTCATCGCTGGTTTCGATGATGGAGTCAT
TGTGGAGAAAGGAAATCATGATGAACTCATGAAAGAGAAAGGCATTTACTTCAAACTTGTCACAATGCAG
ACAGCAGGAAATGAAGTTGAATTAGAAAATGCAGCTGATGAATCCAAAAGTGAAATTGATGCCTTGGAAA
TGTCTTCAAATGATTCAAGATCCAGTCTAATAAGAAAAAGATCAACTCGTAGGAGTGTCCGTGGATCACA
AGCCCAAGACAGAAAGCTTAGTACCAAAGAGGCTCTGGATGAAAGTATACCTCCAGTTTCCTTTTGGAGG
ATTATGAAGCTAAATTTAACTGAATGGCCTTATTTTGTTGTTGGTGTATTTTGTGCCATTATAAATGGAG
GCCTGCAACCAGCATTTGCAATAATATTTTCAAAGATTATAGGGGTTTTTACAAGAATTGATGATCCTGA
AACAAAACGACAGAATAGTAACTTGTTTTCACTATTGTTTCTAGCCCTTGGAATTATTTCTTTTATTACA
TTTTTCCTTCAGGGTTTCACATTTGGCAAAGCTGGAGAGATCCTCACCAAGCGGCTCCGATACATGGTTT
TCCGATCCATGCTCAGACAGGATGTGAGTTGGTTTGATGACCCTAAAAACACCACTGGAGCATTGACTAC
CAGGCTCGCCAATGATGCTGCTCAAGTTAAAGGGGCTATAGGTTCCAGGCTTGCTGTAATTACCCAGAAT
ATAGCAAATCTTGGGACAGGAATAATTATATCCTTCATCTATGGTTGGCAACTAACACTGTTACTCTTAG
CAATTGTACCCATCATTGCAATAGCAGGAGTTGTTGAAATGAAAATGTTGTCTGGACAAGCACTGAAAGA
TAAGAAAGAACTAGAAGGTTCTGGGAAGATCGCTACTGAAGCAATAGAAAACTTCCGAACCGTTGTTTCT
TTGACTCAGGAGCAGAAGTTTGAACATATGTATGCTCAGAGTTTGCAGGTACCATACAGAAACTCTTTGA
GGAAAGCACACATCTTTGGAATTACATTTTCCTTCACCCAGGCAATGATGTATTTTTCCTATGCTGGATG
TTTCCGGTTTGGAGCCTACTTGGTGGCACATAAACTCATGAGCTTTGAGGATGTTCTGTTAGTATTTTCA
GCTGTTGTCTTTGGTGCCATGGCCGTGGGGCAAGTCAGTTCATTTGCTCCTGACTATGCCAAAGCCAAAA
TATCAGCAGCCCACATCATCATGATCATTGAAAAAACCCCTTTGATTGACAGCTACAGCACGGAAGGCCT
AATGCCGAACACATTGGAAGGAAATGTCACATTTGGTGAAGTTGTATTCAACTATCCCACCCGACCGGAC
ATCCCAGTGCTTCAGGGACTGAGCCTGGAGGTGAAGAAGGGCCAGACGCTGGCTCTGGTGGGCAGCAGTG
GCTGTGGGAAGAGCACAGTGGTCCAGCTCCTGGAGCGGTTCTACGACCCCTTGGCAGGGAAAGTGCTGCT
TGATGGCAAAGAAATAAAGCGACTGAATGTTCAGTGGCTCCGAGCACACCTGGGCATCGTGTCCCAGGAG
CCCATCCTGTTTGACTGCAGCATTGCTGAGAACATTGCCTATGGAGACAACAGCCGGGTGGTGTCACAGG
AAGAGATTGTGAGGGCAGCAAAGGAGGCCAACATACATGCCTTCATCGAGTCACTGCCTAATAAATATAG
CACTAAAGTAGGAGACAAAGGAACTCAGCTCTCTGGTGGCCAGAAACAACGCATTGCCATAGCTCGTGCC
CTTGTTAGACAGCCTCATATTTTGCTTTTGGATGAAGCCACGTCAGCTCTGGATACAGAAAGTGAAAAGG
TTGTCCAAGAAGCCCTGGACAAAGCCAGAGAAGGCCGCACCTGCATTGTGATTGCTCACCGCCTGTCCAC
CATCCAGAATGCAGACTTAATAGTGGTGTTTCAGAATGGCAGAGTCAAGGAGCATGGCACGCATCAGCAG
CTGCTGGCACAGAAAGGCATCTATTTTTCAATGGTCAGTGTCCAGGCTGGAACAAAGCGCCAGTGAACTC
TGACTGTATGAGATGTTAAATACTTTTTAATATTTGTTTAGATATGACATTTATTCAAAGTTAAAAGCAA
ACACTTACAGAATTATGAAGAGGTATCTGTTTAACATTTCCTCAGTCAAGTTCAGAGTCTTCAGAGACTT
CGTAATTAAAGGAACAGAGTGAGAGACATCATCAAGTGGAGAGAAATCATAGTTTAAACTGCATTATAAA
TTTTATAACAGAATTAAAGTAGATTTTAAAAGATAAAATGTGTAATTTTGTTTATATTTTCCCATTTGGA
CTGTAACTGACTGCCTTGCTAAAAGATTATAGAAGTAGCAAAAAGTATTGAAATGTTTGCATAAAGTGTC
TATAATAAAACTAAACTTTCATGTGAAA


More InformationEdit

  1. Yuzo: P-Glycoprotein: Introduction
  2. Yuzo: P-Glycoprotein: Biological function
  3. Yuzo: P-Glycoprotein: Biosynthesis
  4. Yuzo: P-Glycoprotein: Gene sequence
  5. Yuzo: P-Glycoprotein: Amino acid sequence and composition
  6. Yuzo: P-Glycoprotein: Domains and structural motifs
  7. Yuzo: P-Glycoprotein: Interactions with macromolecules and small molecules
  8. Yuzo: P-Glycoprotein: Molecular biodiversity and evolution
  9. Yuzo: P-Glycoprotein: Literature overview
  10. Yuzo: P-Glycoprotein: Online resources

Ad blocker interference detected!


Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers

Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.