FANDOM


Jb2090500001

Annotated Bacillis anthraces pXO1 plasmid containing the sequence for lethal factor denoted "lef". Photo courtesy of J Bacteriol. 1999 October; 181(20): 6509–6515..

Lethal factor complete gene sequence can be found at GenBank, Bacillus anthracis lethal factor (nt 1-3291). Of the 3291 nucleotides, AA 685-3114 is the protein encoding region. Computer sequence of the lethal factor gene was submitted by J. Lowe on Novermber 29, 1989.

Lethal factor gene is found on the 181,654 bp pXO1 plasmid in Bacillus anthracis. The complete lethal factor sequence can also be found at FASTA Lethal Factor Sequence. Contained in the 809 bp lethal factor sequence is a 218bp N and C terminal domain, a 287bp middle domain, and another 220bp N and C terminal domain (courtesy of NCBI). 

Sequencing and annotation of the pXO1 gene was performed by R.T. Okinaka at al. and published in 1999. The article can be found at Sequence and organization of pXO1. The plasmid, containing 32.5% G-C content, was sequenced using shotgun sequencing. 

Project PagesEdit

  1. Patrick: Anthrax Toxin: Introduction 
  2. Patrick: Anthrax Toxin: Biological Function
  3. Patrick: Anthrax Toxin: Biosynthesis
  4. Patrick: Anthrax Toxin: Gene Sequence
  5. Patrick: Anthrax Toxin: Amino Acid Sequence and Composition
  6. Patrick: Anthrax Toxin: Secondary and Tertiary Structure
  7. Patrick: Anthrax Toxin: Domains and Structural Motifs
  8. Patrick: Anthrax Toxin: Interactions with macromolecules and small molecules
  9. Patrick: Anthrax Toxin: Molecular biodiversity and evolution
  10. Patrick: Anthrax Toxin: PyMOL Images
  11. Patrick: Anthrax Toxin: Literature Review
  12. Patrick: Anthrax Toxin: Useful online resources

ReferencesEdit

Okinaka, R.T. et al. 1999. Sequence and Organization of pXO1, the Large Bacillus anthracis Plasmid Harboring the Anthrax Toxin GenesJ Bacteriol. 181(20): 6509-6515. 

Complete Sequence FASTA Format Edit

AAATTAGGATTTCGGTTATGTTTAGTATTTTTTTAAAATAATAGTATTAAATAGTGGAATGCAAATGATA
AATGGGCTTTAAACAAAACTAATGAAATAATCTACAAATGGAATTTCTCCAGTTTTAGATTAAACCATAC
CAAAAAAATCACACTGTCAAGAAAAATGATAGAATCCCTACACTAATTAACATAACCAAATTGGTAGTTA
TAGGTAGAAACTTATTTATTTCTATAATACCATGCAAAAAAGTAAATATTCTGTTCCATACTATTTTAGT
AAATTATTTAGCAAGTAAATTTTGGTGTATAAACAAAGTTTATCTTAATATAAAAAATTACTTTACTTTT
ATACAGATTAAAATGAAAAATTTTTTATGACAAGAAATATTGCCTTTAATTTATGAGGAAATAAGTAAAA
TTTTCTACATACTTTATTTTATTGTTGAAATGTTCACTTATAAAAAAGGAGAGATTAAATATGAATATAA
AAAAAGAATTTATAAAAGTAATTAGTATGTCATGTTTAGTAACAGCAATTACTTTGAGTGGTCCCGTCTT
TATCCCCCTTGTACAGGGGGCGGGCGGTCATGGTGATGTAGGTATGCACGTAAAAGAGAAAGAGAAAAAT
AAAGATGAGAATAAGAGAAAAGATGAAGAACGAAATAAAACACAGGAAGAGCATTTAAAGGAAATCATGA
AACACATTGTAAAAATAGAAGTAAAAGGGGAGGAAGCTGTTAAAAAAGAGGCAGCAGAAAAGCTACTTGA
GAAAGTACCATCTGATGTTTTAGAGATGTATAAAGCAATTGGAGGAAAGATATATATTGTGGATGGTGAT
ATTACAAAACATATATCTTTAGAAGCATTATCTGAAGATAAGAAAAAAATAAAAGACATTTATGGGAAAG
ATGCTTTATTACATGAACATTATGTATATGCAAAAGAAGGATATGAACCCGTACTTGTAATCCAATCTTC
GGAAGATTATGTAGAAAATACTGAAAAGGCACTGAACGTTTATTATGAAATAGGTAAGATATTATCAAGG
GATATTTTAAGTAAAATTAATCAACCATATCAGAAATTTTTAGATGTATTAAATACCATTAAAAATGCAT
CTGATTCAGATGGACAAGATCTTTTATTTACTAATCAGCTTAAGGAACATCCCACAGACTTTTCTGTAGA
ATTCTTGGAACAAAATAGCAATGAGGTACAAGAAGTATTTGCGAAAGCTTTTGCATATTATATCGAGCCA
CAGCATCGTGATGTTTTACAGCTTTATGCACCGGAAGCTTTTAATTACATGGATAAATTTAACGAACAAG
AAATAAATCTATCCTTGGAAGAACTTAAAGATCAACGGATGCTGTCAAGATATGAAAAATGGGAAAAGAT
AAAACAGCACTATCAACACTGGAGCGATTCTTTATCTGAAGAAGGAAGAGGACTTTTAAAAAAGCTGCAG
ATTCCTATTGAGCCAAAGAAAGATGACATAATTCATTCTTTATCTCAAGAAGAAAAAGAGCTTCTAAAAA
GAATACAAATTGATAGTAGTGATTTTTTATCTACTGAGGAAAAAGAGTTTTTAAAAAAGCTACAAATTGA
TATTCGTGATTCTTTATCTGAAGAAGAAAAAGAGCTTTTAAATAGAATACAGGTGGATAGTAGTAATCCT
TTATCTGAAAAAGAAAAAGAGTTTTTAAAAAAGCTGAAACTTGATATTCAACCATATGATATTAATCAAA
GGTTGCAAGATACAGGAGGGTTAATTGATAGTCCGTCAATTAATCTTGATGTAAGAAAGCAGTATAAAAG
GGATATTCAAAATATTGATGCTTTATTACATCAATCCATTGGAAGTACCTTGTACAATAAAATTTATTTG
TATGAAAATATGAATATCAATAACCTTACAGCAACCCTAGGTGCGGATTTAGTTGATTCCACTGATAATA
CTAAAATTAATAGAGGTATTTTCAATGAATTCAAAAAAAATTTCAAATATAGTATTTCTAGTAACTATAT
GATTGTTGATATAAATGAAAGGCCTGCATTAGATAATGAGCGTTTGAAATGGAGAATCCAATTATCACCA
GATACTCGAGCAGGATATTTAGAAAATGGAAAGCTTATATTACAAAGAAACATCGGTCTGGAAATAAAGG
ATGTACAAATAATTAAGCAATCCGAAAAAGAATATATAAGGATTGATGCGAAAGTAGTGCCAAAGAGTAA
AATAGATACAAAAATTCAAGAAGCACAGTTAAATATAAATCAGGAATGGAATAAAGCATTAGGGTTACCA
AAATATACAAAGCTTATTACATTCAACGTGCATAATAGATATGCATCCAATATTGTAGAAAGTGCTTATT
TAATATTGAATGAATGGAAAAATAATATTCAAAGTGATCTTATAAAAAAGGTAACAAATTACTTAGTTGA
TGGTAATGGAAGATTTGTTTTTACCGATATTACTCTCCCTAATATAGCTGAACAATATACACATCAAGAT
GAGATATATGAGCAAGTTCATTCAAAAGGGTTATATGTTCCAGAATCCCGTTCTATATTACTCCATGGAC
CTTCAAAAGGTGTAGAATTAAGGAATGATAGTGAGGGTTTTATACACGAATTTGGACATGCTGTGGATGA
TTATGCTGGATATCTATTAGATAAGAACCAATCTGATTTAGTTACAAATTCTAAAAAATTCATTGATATT
TTTAAGGAAGAAGGGAGTAATTTAACTTCGTATGGGAGAACAAATGAAGCGGAATTTTTTGCAGAAGCCT
TTAGGTTAATGCATTCTACGGACCATGCTGAACGTTTAAAAGTTCAAAAAAATGCTCCGAAAACTTTCCA
ATTTATTAACGATCAGATTAAGTTCATTATTAACTCATAAGTAATGTATTAAAAATTTTCAAATGGATTT
AATAATAATAATAATAATAATAATAACGGGACCAGCCATTATGAAGCAACTAATTCTAGACTTGATAGTA
ATTCTTGGGAAGCACCAGATAGTGTAAAAGGTGGCATTGCCAGAATGATATTTTATGTGTTCGTTAGATA
TGAAGGCAAAAACAATGATCCTGACCTAGAACTTAATGATAATGTTATTAATAATTTAATGCCTTTTATA
GGAATATTAGTAAAAGTGCCGAAAAGATCCTGTTGCAAAGCTTTTAAAGAACATATTATTCTATCAAGTG
GCTGTATATTTTGTGTAATTTTCAATAAATTTTGTAATTAAGCATACGTCAAAAAACCGAAATCTGAGCT
C

Ad blocker interference detected!


Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers

Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.