FANDOM


RNA sequence of protease coding segment of HIV-1

Sequence of the segment of the HIV-1 RNA genome that encodes protease. Note that the protease is part of the gag-pol protein

HIV-1 protease is encoded by the genomic RNA of this retrovirus. The sequence of 4619 complete HIV-1 isolates is available in the HIV sequence database at Los Alamos National Laboratory, but the current version of the reference sequence for the complete HIV-1 genome is NC_001802.1. The reference sequence represents a clinical isolate that was obtained from an AIDS patient in France in 1983, early in the global HIV outbreak.

HIV-1 complete reference sequence (9181 nt): GenBank format, FASTA format). The segment from position 1799 through 2095 encoodes the protease.



HIV-1 protease cDNA sequence in FASTA format:Edit

>ENA|CAA09312|CAA09312.1 Human immunodeficiency virus partial HIV-1 protease : Location:1..297
CCTCAGGTCACTCTTTGGCAACGACCCATAGTCACAATAAAGATAGGGGGGCAACTAAAG
GAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGA
AAATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGAT
CAGGTATCCATAGAAATCTGCGGACATAAAGCTATAGGTACAGTATTAATAGGACCTACA
CCTGTCAACATAATTGGAAGGAATCTGTTGACTCAGCTTGGCTGCACTTTAAATTTT

Ad blocker interference detected!


Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers

Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.