FANDOM


The Oxygen Evolving Complex sequence is 1048 nucleotides long.

The EBI ID number for this sequence is: NRN_DM373233

Below is the nucleotide sequence of the A/12 chain in Photosystem II (FASTA format):

>NRNL1:NRN_DM373233 PN:JP2009165391 A
ATGACCACAACTCTCCAACGTCGCGAAAGCGCGAATTTGTGGGAGCGGTTTTGTAACTGGGTGACGAGCACCGATAACCG
CCTTTATGTGGGCTGGTTTGGGGTGATCATGATCCCCACCCTATTAGCCGCAACCATCTGCTTTGTGATTGCCTTCATCG
CTGCTCCCCCTGTGGACATCGATGGCATCCGTGAGCCTGTTTCTGGCTCTTTGCTCTATGGCAACAACATCATCACGGGT
GCAGTTGTCCCCTCTAGCAACGCCATTGGCTTGCACTTCTACCCCATTTGGGAAGCTGCTTCCCTCGATGAGTGGCTCTA
CAACGGTGGCCCCTACCAACTGATCATCTTCCACTTCCTGTTGGGTGCCTCCTGCTACATGGGTCGCCAGTGGGAACTCA
GCTACCGCCTCGGTATGCGGCCTTGGATCTGCGTGGCCTACTCTGCCCCCCTGGCTTCTGCCTTTGCAGTCTTCTTGATC
TACCCCATTGGTCAAGGCAGCTTCTCTGACGGGATGCCCCTCGGTATCTCTGGTACCTTCAACTTTATGATTGTGTTCCA
AGCGGAGCACAACATTCTCATGCACCCCTTCCACCAACTGGGTGTAGCCGGTGTCTTTGGTGGGGCGCTGTTCTGCGCCA
TGCACGGTTCTCTGGTGACCTCCAGCTTGATCCGTGAAACCACCGAAACCGAATCCGCCAACTACGGTTACAAATTTGGT
CAAGAGGAAGAAACCTACAACATCGTGGCTGCCCACGGTTACTTTGGCCGGTTGATCTTCCAATACGCCAGCTTCAACAA
CAGCCGCTCCCTGCACTTCTTCTTGGCCGCTTGGCCGGTGGTGGGTGTGTGGTTTACCGCCTTGGGGATCAGCACCATGG
CCTTTAACCTGAATGGCTTCAACTTCAACCACTCGGTCATTGATGCCAAGGGCAACGTGATCAACACCTGGGCGGACATC
ATCAACCGTGCCAACTTGGGTATGGAAGTGATGCACGAGCGCAATGCTCACAACTTCCCCCTCGACTTGGCCAGCGCTGA
GTCTGCTCCTGTGGCCATGATTGCTCCCAGCATCAACGGCTAA

The Light-Harvesting Complex sequence is 1709 nucleotides long.

The EBI ID number for this sequence is: AM231284

Below is the nucleotide sequence of Chain A in the LHCII (FASTA format):

>ENA|AM231284|AM231284.5 Spinacia oleracea lhcb1.3 gene for major chlorophyll a/b binding protein LHCb1.3 
TGTTCATGAAAGTGAAAAATGTGCTTCAACTCATTTGTTTGATCCAAATACAAAAATATG
GCTAAAACTGAATGACTTGTAATCCGGTTAAAAAACAAAGCACTACGATAAACCGACCCA
AAACCGACCCAAAACCGACCAATTCACTACTTAATACGTACAAGTGATAACTTATAACTC
GCCTCACAAAATTACAATATTGCTACACATTGACGAGACACATGGGTGAGAGTTGGGACC
TTGTGGCTTGTGGCCTTGTGGTTGTGAGTCGTTAAGGTCCTACAATTAACACCAAGAGAT
TTCTACTTGATTAATGCAATCCAAAACCCTCCAAATGTCATCTCATCATTGGTCAGCAAC
CTCTGGTTAGAAATAAATCTCCAAAATGCATGGCTTAGACATTTGCCAACTAACACAACA
CCAAAATCTTCCTAAGCAAATAAGAAACCAGATAAAGATATGTTAGATATCCCTTAGATA
AGAAGATACCCCATTTCCTTTTATATAAAAAACAACCCTAAACTTATTAACTTTTCATTC
ATCACTACAACATCATCAAACACATTACATTACTGATTACTCTCACTTTCCCCTTTCTTC
TTTAGCAATGGCTTCCTCCACTATGGCTCTCTCTTCCCCTTCTCTTGCCGGGAAGGCTGT
AAAGCTCGGCCCAACCGCCTCGGAAATCATTGGTGAGGGAAGGATCACCATGAGGAAGAC
TGCAGGAAAGCCCAAAACTGTTCAATCAAGCAGCCCATGGTACGGCCCAGACCGTGTTAA
GTACTTGGGCCCATTCTCCGGTGAGAGCCCATCATACCTCACCGGTGAGTTCCCTGGTGA
CTACGGTTGGGACACTGCTGGGCTTTCAGCTGACCCAGAAACCTTCGCTAAGAACCGTGA
GCTTGAAGTTATCCACTGCAGGTGGGCTATGTTGGGAGCATTGGGTTGTGTTTTCCCAGA
GCTCTTGGCCCGTAATGGTGTTAAGTTCGGTGAGGCCGTTTGGTTTAAGGCGGGTTCACA
AATCTTTAGCGAGGGTGGGCTTGACTACTTGGGTAACCCAAGTTTGGTCCATGCTCAAAG
TATCCTTGCTATTTGGGCCTGTCAAGTTATCTTGATGGGTGCTGTTGAGGGGTACCGTAT
TGCTGGTGGGCCTCTTGGTGAGGTGGTTGACCCACTTTACCCTGGTGGTAGCTTTGACCC
ATTGGGCTTGGCTGATGACCCAGAAGCCTTCGCTGAGTTGAAGGTGAAGGAAATTAAGAA
TGGTAGGTTGGCTATGTTTTCCATGTTTGGGTTCTTTGTTCAAGCTATTGTTACCGGAAA
GGGCCCATTGGAAAACCTCGCTGACCACCTTGCTGACCCGGTTAACAACAATGCTTGGAA
CTTTGCCACCAACTTTGTCCCCGGAAAGTGAAGGGGTAGTTTCTAGGATGTTAGGGAAGG
TCGAGAAGGTGTTGTTTTCACAGTTTAGAACTTCTTGTGCTTCAATGTAAATTTGTGTTT
GGTCCAGATTAATGAATGAATATAATGCTTATTTTGCTACAAGGATTTATCTAATGATCA
ATTCAATTGTTTAAAGATTAAAACCCAATATAAACATAGTGATTTAATTATCAATTCAAT
TGTTTAAAAATTAAAACTCAATATGAACATAATGATTTATTAATTTTACTACAAGGATTT
ATCAATTCAATTGTTTAAAAATTAAAACT


PagesEditEdit

  1. Rogelio: Photosystem II: Introduction
  2. Rogelio: Photosystem II: Biological function
  3. Rogelio: Photosystem II: Biosynthesis
  4. Rogelio: Photosystem II: Gene sequence
  5. Rogelio: Photosystem II: Amino acid sequence and composition
  6. Rogelio: Photosystem II: Secondary and tertiary structure
  7. Rogelio: Photosystem II: Domains and structural motifs
  8. Rogelio: Photosystem II: Interactions with macromolecules and small molecules
  9. Rogelio: Photosystem II: Molecular biodiversity and evolution
  10. Rogelio: Photosystem II: Literature overview
  11. Rogelio: Photosystem II: Useful online resources

Ad blocker interference detected!


Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers

Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.