FANDOM


This gene encodes a member of the cytochrome p450 superfamily of enzymes. The cytochrome p450 proteins are monooxygenases that catalyze many reactions involving drug metabolism and synthesis of cholesterol, steriods, and other lipids. This particular version of the enzyme is a hydroxylase that metabolizes arachidonic acid, docosahexaenoic acid, and other long chain fatty acids.  The protein coding region is found from the amino acid residue 434 to 443. However, CYP3A4 has 643 SNP. The EBI page with information reguarding CYP3A4 gene expression can be seen here.  
Screen Shot 2014-03-11 at 8.07.14 AM

CYP3A4 is expressed in the liver and has a conserved region from AA residue 434 to 443.

Gene Sequence

ATGGACGTCATAACCTCGACGAGTTTTGGAGTTAATATAGACTCATTAAACAATCCGCAAGACCCTTTCGTCGAGAATACAAAGAAGCTGCTTAGATTCGACTTCTTGGATCCATTCTTTTTGTCTATCACTGTGTTCCCCTTTTTAATTCCCATATTAGAAGTTCTGAACATATGCGTATTCCCTCGCGAGGTAACTAACTTCCTCAGGAAAAGCGTTAAGCGTATGAAAGAATCACGATTGGAGGATACCCAAAAACATAGGGTTGATTTTCTGCAACTAATGATAGACTCGCAGAATTCGAAAGAAACAGAGTCCCATAAAGCCCTATCAGACCTAGAGTTGGTGGCGCAGAGTATAATCTTTATATTCGCGGGATATGAGACCACTAGCAGCGTTTTATCATTCATTATGTACGAGCTAGCTACCCATCCGGACGTTCAGCAAAAGCTCCAGGAGGAGATTGACGCTGTATTGCCAAACAAAGCCCCTCCTACGTACGATACAGTACTGCAAATGGAATACCTCGACATGGTCGTTAACGAGACACTACGATTATTTCCAATAGCAATGAGACTAGAGAGAGTGTGTAAGAAAGACGTTGAGATCAATGGTATGTTCATTCCGAAGGGTGTGGTGGTGATGATTCCGAGCTACGCACTCCATCGAGATCCAAAATATTGGACGGAACCTGAAAAGTTTTTACCTGAAAGGTTTTCAAAGAAAAATAAGGATAACATTGATCCATACATATATACTCCCTTCGGGTCAGGACCGCGCAACTGCATTGGAATGCGATTCGCGTTGATGAATATGAAACTCGCGCTCATTAGAGTACTGCAGAACTTTAGCTTCAAGCCGTGTAAAGAGACACAGATACCACTCAAATTATCACTGGGCGGCTTGCTTCAGCCAGAAAAACCGGTTGTTCTGAAGGTAGAAAGTCGAGACGGAACGGTGTCCGGCGCG

PagesEdit

  1. Alessandra: Cytochrome p450: Introduction
  2. Alessandra: Cytochrome p450: Biological function
  3. Alessandra: Cytochrome p450: Biosynthesis
  4. Alessandra: Cytochrome p450: Gene sequence
  5. Alessandra: Cytochrome p450: Amino acid sequence and composition
  6. Alessandra: Cytochrome p450: Secondary and tertiary structure
  7. Alessandra: Cytochrome p450: Domains and structural motifs
  8. Alessandra: Cytochrome p450: Interactions with macromolecules and small molecules
  9. Alessandra: Cytochrome p450: Molecular biodiversity and evolution
  10. Alessandra: Cytochrome p450: Literature overview
  11. Alessandra: Cytochrome p450: Useful online resources

Ad blocker interference detected!


Wikia is a free-to-use site that makes money from advertising. We have a modified experience for viewers using ad blockers

Wikia is not accessible if you’ve made further modifications. Remove the custom ad blocker rule(s) and the page will load as expected.